Search results for " antibacterial activity"
showing 10 items of 19 documents
Ionogels: Multifaced Materials
Anthemis wiedemanniana essential oil prevents LPS-induced production of NO in RAW 264.7 macrophages and exerts antiproliferative and antibacterial ac…
2012
Anthemis wiedemanniana is known in folk medicine for the treatment of microbial infections, cancer and also urinary and pulmonary problems. In this study, the chemical composition of the essential oil from A. wiedemanniana was evaluated and its antibacterial activity was tested against 10 bacterial strains. The oil was also tested for its potentiality to inhibit nitric oxide production in RAW 264.7 macrophages and for its cytotoxicity against four human cancer cell lines. A. wiedemanniana oil, rich of oxygenated monoterpenes (25.4%), showed a good antibacterial activity against Gram-positive bacteria and a good activity against the two Gram-negative bacteria, Escherichia coli and Proteus vu…
Chemical Composition and antimicrobial activity of the essential oils from two species of Thimus growing wild in southern Italy
2009
The volatile constituents of the aerial parts of two samples of Thymus longicaulis C. Presl, collected in Campania and in Sicily, and two samples of Thymus pulegioides L. from the same regions, were extracted by hydrodistillation and analyzed. Considering the four oils together, seventy-eight different compounds were identified: 57 for Thymus longicaulis from Sicily (91.1% of the total oil), 40 for Thymus longicaulis from Campania (91.5% of the oil), 39 for Thymus pulegioides from Sicily (92.5% of the oil) and 29 for Thymus pulegioides from Campania (90.1% of the oil). The composition of the oils is different, although the most abundant components are identical in T. pulegioides. The essent…
Antibacterial activity of Borago officinalis and Brassica juncea aqueous extracts evaluated in vitro and in situ using different food model systems
2014
The present study was undertaken to characterize the antibacterial activity of the aqueous extracts (AEs) obtained from the leaves of Borago officinalis L. and Brassica juncea L. The antagonistic activity was evaluated against several bacteria (42 strains of Listeria monocytogenes, 35 strains of Staphylococcus aureus, 38 strains of Enterobacter spp. and 18 strains of Salmonella enterica) commonly associated with foodborne diseases by paper disc diffusion method. The susceptibility to the plant extracts was strain specific. Thirty-five strains (7 L. monocytogenes, 11 S. aureus, 1 S. Enteritidis, 1 S. Veneziana, 7 Enterobacter hormaechei, 5 Enterobacter cloacae, 1 Enterobacter sakazakii and 2…
Paper Functionalized with Nanostructured TiO2/AgBr: Photocatalytic Degradation of 2–Propanol under Solar Light Irradiation and Antibacterial Activity
2020
A facile method to produce paper&ndash
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
The Mucus of Actinia equina (Anthozoa, Cnidaria): An Unexplored Resource for Potential Applicative Purposes
2015
The mucus produced by many marine organisms is a complex mixture of proteins and polysaccharides forming a weak watery gel. It is essential for vital processes including locomotion, navigation, structural support, heterotrophic feeding and defence against a multitude of environmental stresses, predators, parasites, and pathogens. In the present study we focused on mucus produced by a benthic cnidarian, the sea anemone Actinia equina (Linnaeus, 1758) for preventing burial by excess sedimentation and for protection. We investigated some of the physico-chemical properties of this matrix such as viscosity, osmolarity, electrical conductivity, protein, carbohydrate, and total lipid contents. Som…
Medicinal Properties of Mediterranean Oyster Mushrooms: Species of Genus Pleurotus (Higher Basidiomycetes)
2017
The term “Mediterranean area,” applied in this chapter, refers to the definition reported in Med-Checklist and particularly to all countries bordering the Mediterranean Sea plus Portugal, Bulgaria, the Crimea (Ukraine), and Jordan. The “Mediterranean oyster mushrooms” is a geographically and ecologically well-defined group of Basidiomycetes. The medicinal properties of some widely investigated species such as Pleurotus ostreatus and P. eryngii are recognized worldwide, while in the case of some other Mediterranean Pleurotus taxa, there is still a lack of knowledge. A substantial increase in knowledge about the anticancer and antibacterial properties of the group of Pleurotus species growing…
Photosynthesized silver-polyaminocyclodextrin nanocomposites as promising antibacterial agents with improved activity
2016
Ag nanocomposites were prepared by photoreduction of ammoniacal silver acetate in the presence of poly-{6-[3-(2-(3-aminopropylamino)ethylamino)propylamino]}-(6-deoxy)-β-CD (amCD). The obtained systems were characterized by means of various complementary techniques (UV-vis, FT-IR, TEM, SAED). In particular, FT-IR spectroscopy evidenced a partial oxidative degradation of the polyamine branches of the capping auxiliary, due to the fact that these groups function as a sacrificial reducing agent in the photoinduced formation of the Ag metal core. TEM and SAED micrographs showed that the Ag cores possess a relatively low polydispersity and a significantly crystalline character. The Ag–amCD system…
Bioactive compounds from brown algae inhabiting the north-western Mediterranean Sea
2021
Marine algae produce a great amount of secondary metabolites (e.g. terpenoids, fatty acids, steroids, polysaccharides and polyphenols) to face environmental stressors they are exposed to, but also to defend themselves from biological pressures such as competitors, pathogens, grazers and epiphytes. Over the last decade, secondary metabolites isolated from brown algae and phenolic compounds, in particular, are receiving increasing attention due to their putative ecological roles, and several biological properties. Brown fucoid algae of the genus Cystoseira sensu latu (Sargassaceae) and Dictyotaceae produce a wide variety of secondary metabolites which have been investigated mainly for their d…